Introduction to Unix

A hands-on-workshop covering the basics of the Unix/Linux command line interface

How to use this workshop

The workshop is broken up into a number of Topics each focusing on a particular aspect of Unix. You should take a short break between each to refresh and relax before tackling the next.

Topics may start with some background followed by a number of exercises. Each exercise begins with a question, then sometimes a hint (or two) and finishes with the suggested answer.

Question

An example question looks like:

What is the Answer to Life?

Hint

Depending on how much of a challenge you like, you may choose to use hints. Even if you work out the answer without hints, its a good idea to read the hints afterwards because they contain extra information that is good to know.

Note: hints may be staged, that is, there may be a more section within a hint for further hints

Hint <- click here to reveal hint

What is the answer to everything?

As featured in "The Hitchhiker's Guide to the Galaxy"

More <- and here to show more

It is probably a two digit number

Answer

Once you have worked out the answer to the question expand the Answer section to check if you got it correct.

Answer <- click here to reveal answer

Answer: 42

Ref: Number 42 (Wikipedia)

Usage Style

This workshop attempts to cater for two usage styles:

  1. Problem solver: for those who like a challenge and learn best be trying to solve the problems by-them-selves (hints optional):
    • Attempt to answer the question by yourself.
    • Use hints when you get stuck.
    • Once solved, reveal the answer and read through our suggested solution.
    • Its a good idea to read the hints and answer description as they often contain extra useful information.
  2. By example: for those who learn by following examples: Expand all sections
    • Expand the Answer section at the start of each question and follow along with the commands that are shown and check you get the same (or similar) answers.
    • Its a good idea to read the hints and answer description as they often contain extra useful information.

Topic 1: Remote log in

In this topic we will learn how to connect to a Unix computer via a method called SSH and run a few basic commands.

Connecting to a Unix computer

To begin this workshop you will need to connect to an HPC. Today we will use the LIMS-HPC. The computer called lims-hpc-m (m is for master which is another name for head node) is the one that coordinates all the HPCs tasks.

Server details:

  • host: lims-hpc-m.latrobe.edu.au
  • port: 6022
  • username: trainingXX (where XX is a two digit number, provided at workshop)
  • password: (provided at workshop)

Both Mac OS X and Linux come with a version of ssh (called OpenSSH) that can be used from the command line. To use OpenSSH you must first start a terminal program on your computer. On OS X the standard terminal is called Terminal, and it is installed by default. On Linux there are many popular terminal programs including: xterm, gnome-terminal, konsole (if you aren't sure, then xterm is a good default). When you've started the terminal you should see a command prompt. To log into LIMS-HPC, for example, type this command at the prompt and press return (where the word username is replaced with your LIMS-HPC username):

ssh -p 6022 username@lims-hpc-m.latrobe.edu.au

The same procedure works for any other machine where you have an account except most other HPCs will not need the -p 6022 (which is telling ssh to connect on a non-standard port number).

You may be presented with a message along the lines of:

The authenticity of host 'lims-hpc-m.latrobe.edu.au (131.172.36.150)' can't be  established.
...
Are you sure you want to continue connecting (yes/no)?

Although you should never ignore a warning, this particular one is nothing to be concerned about; type yes and then press enter. If all goes well you will be asked to enter your password. Assuming you type the correct username and password the system should then display a welcome message, and then present you with a Unix prompt. If you get this far then you are ready to start entering Unix commands and thus begin using the remote computer.

On Microsoft Windows (Vista, 7, 8) we recommend that you use the PuTTY ssh client. PuTTY (putty.exe) can be downloaded from this web page:

http://www.chiark.greenend.org.uk/~sgtatham/putty/download.html

Documentation for using PuTTY is here:

http://www.chiark.greenend.org.uk/~sgtatham/putty/docs.html

When you start PuTTY you should see a window which looks something like this:

Putty Connection Dialog

To connect to LIMS-HPC you should enter its hostname into the box entitled "Host Name (or IP address)" and 6022 in the port, then click on the Open button. All of the settings should remain the same as they were when PuTTY started (which should be the same as they are in the picture above).

In some circumstances you will be presented with a window entitled PuTTY Security Alert. It will say something along the lines of "The server's host key is not cached in the registry". This is nothing to worry about, and you should agree to continue (by clicking on Yes). You usually see this message the first time you try to connect to a particular remote computer.

If all goes well, a terminal window will open, showing a prompt with the text "login as:". An example terminal window is shown below. You should type your LIMS-HPC username and press enter. After entering your username you will be prompted for your password. Assuming you type the correct username and password the system should then display a welcome message, and then present you with a Unix prompt. If you get this far then you are ready to start entering Unix commands and thus begin using the remote computer.

Putty login screen

Note: for security reasons ssh will not display any characters when you enter your password. This can be confusing because it appears as if your typing is not recognised by the computer. Don’t be alarmed; type your password in and press return at the end.

LIMS-HPC is a high performance computer for La Trobe Users. Logging in connects your local computer (e.g. laptop) to LIMS-HPC, and allows you to type commands into the Unix prompt which are run on the HPC, and have the results displayed on your local screen.

You will be allocated a training account on LIMS-HPC for the duration of the workshop. Your username and password will be supplied at the start of the workshop.

Log out of LIMS-HPC, and log back in again (to make sure you can repeat the process).

All the remaining parts assume that you are logged into LIMS-HPC over ssh.

Exercises

who
whoami
date
cal
hostname
/home/group/common/training/Intro_to_Unix/hi
  • who: displays a list of the users who are currently using this Unix computer.
  • whoami: displays your username (i.e. they person currently logged in).
  • date: displays the current date and time.
  • cal: displays a calendar on the terminal. It can be configured to display more than just the current month.
  • hostname: displays the name of the computer we are logged in to.
  • /home/group/common/training/Intro_to_Unix/hi: displays the text "Hello World"

Topic 2: Exploring your home directory

In this topic we will learn how to "look" at the filesystem and further expand our repertoire of Unix commands.

Duration: 20 minutes.

Relevant commands: ls, pwd, echo, man

Your home directory contains your own private working space. Your current working directory is automatically set to your home directory when you log into a Unix computer.

2.1) Use the ls command to list the files in your home directory. How many files are there?

Literally, type ls and press the ENTER key.

$ ls
exp01  file01  muscle.fq

When running the ls command with no options it will list files in your current working directory. The place where you start when you first login is your HOME directory.

Answer: 3 (exp01, file01 and muscle.fq)


The above answer is not quite correct. There are a number of hidden files in your home directory as well.

2.2) What flag might you use to display all files with the ls command? How many files are really there?

Take the all quite literally.

Type ls --all and press the ENTER key.

Answer 1: --all (or -a) flag

Now you should see several files in your home directory whose names all begin with a dot. All these files are created automatically for your user account. They are mostly configuration options for various programs including the shell. It is safe to ignore them for the moment.

$ ls --all
.              .bash_logout    exp01    .lesshst
..             .bash_profile   file01   muscle.fq
.bash_history  .bashrc         .kshrc   .viminfo

There are two trick files here; namely . and .. which are not real files but instead, shortcuts. . is a shortcut for the current directory and .. a shortcut for the directory above the current one.

Answer 2: 10 files (don't count . and ..)


2.3) What is the full path name of your home directory?

Remember your Current Working Directory start's in your home directory (and the hint from the slides).

Try a shortened version of print working directory

You can find out the full path name of the current working directory with the pwd command. Your home directory will look something like this:

$ pwd
/home/trainingXY

Answer: /home/trainingXY

where XY is replaced by some 2 digit sequence.

Alternate method: You can also find out the name of your home directory by printing the value of the $HOME shell variable:

echo $HOME

2.4) Run ls using the long flag (-l), how did the output change?

Run ls -l

Answer: it changed the output to place 1 file/directory per line. It also added some extra information about each.

$ ls -l
total 32
drwxr-x--- 2 training01 training 2048 Jun 14 11:28 exp01
-rw-r----- 1 training01 training   97 Jun 14 11:28 file01
-rw-r----- 1 training01 training 2461 Jun 14 11:28 muscle.fq

Details:

drwxr-x--- 2 training01 training 2048 Jun 14 11:28 exp01
\--------/ ^ \--------/ \------/ \--/ \----------/ \---/
permission |  username   group   size    date       name
       /---^---\
       linkcount

Where:

  • permissions: 4 parts, file type, user perms, group perms and other perms
    • filetype: 1 character, d = directory and - regular file
    • user permissions: 3 characters, r = read, w = write, x = execute and - no permission
    • group permissions: same as user except for users within the owner group
    • other permissions: same as user except for users that are not in either user or group
  • username: the user who owns this file/directory
  • group: the group name who owns this file/directory
  • size: the number of bytes this file/directory takes to store on disk
  • date: the date and time when this file/directory was last edited
  • name: name of the file
  • linkcount: technical detail which represents the number of links this file has in the file system (safe to ignore)

2.5) What type of file is exp01 and muscle.fq?

Check the output from the ls -l.

Answer:

  • exp01: Directory (given the 'd' as the first letter of its permissions)
  • muscle.fq: Regular File (given the '-')

2.6) Who has permission to read, write and execute your home directory?

You can also give ls a filename as the first option.

ls -l will show you the contents of the CWD; how might you see the contents of the parent directory? (remember the slides)

If you pass the -l flag to ls it will display a "long" listing of file information including file permissions.

There are various ways you could find out the permissions on your home directory.

Method 1: given we know the CWD is our home directory.

$ ls -l ..
...
drwxr-x--- 4 trainingXY training  512 Feb  9 14:18 trainingXY
...

The .. refers to the parent directory.

Method 2: using $HOME. This works no matter what our CWD is set to.

You could list the permissions of all files and directories in the parent directory of your home:

$ ls -l $HOME/..
...
drwxr-x--- 4 trainingXY training  512 Feb  9 14:18 trainingXY
...

In this case we use the shell variable to refer to our home directory.

Method 3: using ~ (tilde) shortcut

You may also refer to your home directory using the ~ (tilde) character:

$ ls -l ~/..
...
drwxr-x--- 4 trainingXY training  512 Feb  9 14:18 trainingXY
...

All 3 of the methods above mean the same thing.

You will see a list of files and directories in the parent directory of your home directory. One of them will be the name of your home directory, something like trainingXY. Where XY is replaced by a two digit string

Altername: using the -a flag and looking at the . (dot) special file.

$ ls -la
...
drwxr-x--- 4 trainingXY training  512 Feb  9 14:18 .
...

Answer: drwxr-x---

  • You: read (see filenames), write (add, delete files), execute (change your CWD to this directory).
  • Training users: read, execute
  • Everyone else: No access

Discussion on Permissions:

The permission string is "drwxr-x---". The d means it is a directory. The rwx means that the owner of the directory (your user account) can read, write and execute the directory. Execute permissions on a directory means that you can cd into the directory. The r-x means that anyone in the same user group as training can read or execute the directory. The --- means that nobody else (other users on the system) can do anything with the directory.


man is for manual: and it will be your best friend!

Manual pages include a lot of detail about a command and its available flags/options. It should be your first (or second) port of call when you are trying to work out what a command or option does.

You can scroll up and down in the man page using the arrow keys.

You can search in the man page using the forward slash followed by the search text followed by the ENTER key. e.g. type /hello and press ENTER to search for the word hello. Press n key to find next occurance of hello etc.

You can quit the man page by pressing q.


2.7) Use the man command to find out what the -h flag does for ls

Give ls as an option to man command.

man ls

Use the following command to view the man page for ls:

$ man ls

Answer: You should discover that the -h option prints file sizes in human readable format

-h, --human-readable
              with -l, print sizes in human readable format (e.g., 1K 234M 2G)

2.8) Use the -h, how did the output change of muscle.fq?

Don't forget the -l option too.

Run ls -lh

$ ls -lh
...
-rw-r----- 1 training01 training 2.5K Jun 14 11:28 muscle.fq

Answer: it changed the output so the filesize of muscle.fq is now 2.5K instead of 2461

Topic 3: Exploring the file system

In this topic we will learn how to move around the filesystem and see what is there.

Duration: 30 minutes.

Relevant commands: pwd, cd, ls, file

3.1) Print the value of your current working directory.

The pwd command prints the value of your current working directory.

$ pwd
/home/training01

3.2) List the contents of the root directory, called '/' (forward slash).

ls expects a single option which is the directory to change too.

$ ls /
applications-merged  etc         media    root     tmp
bin                  home        mnt      sbin     usr
boot                 lib         oldhome  selinux  var
data                 lib64       opt      srv
dev                  lost+found  proc     sys

Here we see that ls can take a filepath as its argument, which allows you to list the contents of directories other than your current working directory.


3.3) Use the cd command to change your working directory to the root directory. Did your prompt change?

cd expects a single option which is the directory to change to

The cd command changes the value of your current working directory. To change to the root directory use the following command:

$ cd /

Answer: Yes, it now says the CWD is / instead of ~.

Some people imagine that changing the working directory is akin to moving your focus within the file system. So people often say "move to", "go to" or "charge directory to" when they want to change the working directory.

The root directory is special in Unix. It is the topmost directory in the whole file system.


Output on ERROR only: Many Unix commands will not produce any output if everything went well; cd is one such command. However, it will get grumpy if something went wrong by way of an error message on-screen.

3.4) List the contents of the CWD and verify it matches the list in 3.2

ls

Assuming you have changed to the root directory then this can be achieved with ls, or ls -a (for all files) or ls -la for a long listing of all files.

If you are not currently in the root directory then you can list its contents by passing it as an argument to ls:

$ ls
applications-merged  etc         media    root     tmp
bin                  home        mnt      sbin     usr
boot                 lib         oldhome  selinux  var
data                 lib64       opt      srv
dev                  lost+found  proc     sys

Answer: Yes, we got the same output as exercise 3.2


3.5) Change your current working directory back to your home directory. What is the simplest Unix command that will get you back to your home directory from anywhere else in the file system?

The answer to exercise 2.6 might give some hints on how to get back to the home directory

$HOME, ~, /home/trainingXY are all methods to name your home directory. Yet there is a simpler method; the answer is buried in man cd however cd doesn't its own manpage so you will need to search for it.

Use the cd command to change your working directory to your home directory. There are a number of ways to refer to your home directory:

cd $HOME

is equivalent to:

cd ~

The simplest way to change your current working directory to your home directory is to run the cd command with no arguments:

Answer: the simplest for is cd with NO options.

cd

This is a special-case behaviour which is built into cd for convenience.


3.6) Change your working directory to /home/group/common/training/Intro_to_Unix/
cd /home/group/common/training/Intro_to_Unix/

3.7) List the contents of that directory. How many files does it contain?

ls

You can do this with ls

$ ls
expectations.txt  hello.c  hi  jude.txt  moby.txt  sample_1.fastq  sleepy

Answer: 7 files (expectations.txt hello.c hi jude.txt moby.txt sample_1.fastq sleepy)


3.8) What kind of file is /home/group/common/training/Intro_to_Unix/sleepy?

Take the word file quite literally.

file sleepy

Use the file command to get extra information about the contents of a file:

Assuming your current working directory is /home/group/common/training/Intro_to_Unix/

$ file sleepy
Bourne-Again shell script text executable

Otherwise specify the full path of sleepy:

$ file /home/group/common/training/Intro_to_Unix/sleepy
Bourne-Again shell script text executable

Answer: Bourne-Again shell script text executable

The "Bourne-Again shell" is more commonly known as BASH. The file command is telling us that sleepy is (probably) a shell script written in the language of BASH.

The file command uses various heuristics to guess the "type" of a file. If you want to know how it works then read the Unix manual page like so:

man file

3.9) What kind of file is /home/group/common/training/Intro_to_Unix/hi?

Take the word file quite literally.

Use the file command again. If you are in the same directory as hi then:

$ file hi
ELF 64-bit LSB executable, x86-64, version 1 (SYSV), dynamically linked (uses shared libs), for GNU/Linux 
2.6.9, not stripped

Answer: ELF 64-bit LSB executable, x86-64, version 1 (SYSV), dynamically linked (uses shared libs), for GNU/Linux

This rather complicated output is roughly saying that the file called hi contains a binary executable program (raw instructions that the computer can execute directly).


3.10) What are the file permissions of /home/group/common/training/Intro_to_Unix/sleepy? What do they mean?

Remember the ls command, and don't forget the -l flag

You can find the permissions of sleepy using the ls command with the -l flag. If you are in the same directory as sleepy then:

$ ls -l sleepy
-rw-r--r-- 1 arobinson common 183 Feb  9 16:36 sleepy

Answer: We can see that this particular instance of sleepy is owned by the user arobinson, and is part of the common user group. It is 183 bytes in size, and was last modified on the 9th of February at 4:36pm. The file is readable to everyone, and writeable only to training01. The digit '1' between the file permission string and the owner indicates that there is one link to the file. The Unix file system allows files to be referred to by multiple "links". When you create a file it is referred to by one link, but you may add others later. For future reference: links are created with the ln command.


3.11) Change your working directory back to your home directory ready for the next topic.

cd

You should know how to do this with the cd command:

cd

Topic 4: Working with files and directories

In this topic we will start to read, create, edit and delete files and directories.

Duration: 50 minutes.

Relevant commands: mkdir, cp, ls, diff, wc, nano, mv, rm, rmdir, head, tail, grep, gzip, gunzip

Hint: Look at the commands above; you will need them roughly in order for this topic. Use the man command find out what they do, in particular the NAME, SYNOPSIS and DESCRIPTION sections.

4.1) In your home directory make a sub-directory called test.

You are trying to make a directory, which of the above commands looks like a shortened version of this?

mkdir

Make sure you are in your home directory first. If not cd to your home directory.

Use the mkdir command to make new directories:

$ mkdir test

Use the ls command to check that the new directory was created.

$ ls
exp01  file01  muscle.fq  test

4.2) Copy all the files from /home/group/common/training/Intro_to_Unix/ into the newly created test directory.

You are trying to copy, which of the above commands looks like a shortened version of this?

$ man cp
...
SYNOPSIS
       cp [OPTION]... [-T] SOURCE DEST
...
DESCRIPTION
       Copy SOURCE to DEST, or multiple SOURCE(s) to DIRECTORY.

which means cp expects zero or more flags, a SOURCE file followed by a DEST file or directory

Use the cp command to copy files.

Wildcards: You could copy them one-by-one, but that would be tedious, so use the * wildcard to specify that you want to copy all the files.

There are a number of ways you could do this depending on how you specify the source and destination paths to cp. You only need to perform one of these ways, but we show multiple ones for your reference.

Answer 1: From your home directory:

$ cp /home/group/common/training/Intro_to_Unix/* test

Answer 2: Change to the test directory and then copy (assuming you started in your home directory):

$ cd test
$ cp /home/group/common/training/Intro_to_Unix/* .

In the example above the '.' (dot) character refers to the current working directory. It should be the test subdirectory of your home directory.

Answer 3: Change to the /home/group/common/training/Intro_to_Unix/ directory and then copy:

cd /home/group/common/training/Intro_to_Unix/
cp * ~/test

Remember that ~ is a shortcut reference to your home directory.


Note: This exercise assumes that the copy command from the previous exercise was successful.

4.3) Check that the file size of expectations.txt is the same in both the directory that you copied it from and the directory that you copied it to.

Remember ls can show you the file size (with one of its flags)

ls -l

Use ls -l to check the size of files.

You could do this in many ways depending on the value of your working directory. We just show one possible way for each file:

$ ls -l /home/group/common/training/Intro_to_Unix/expectations.txt

$ ls -l ~/test/expectations.txt

From the output of the above commands you should be able to see the size of each file and check that they are the same.

Answer: They should each be 1033773 bytes

Alternate: Sometimes it is useful to get file sizes reported in more "human friendly" units than bytes. If this is true then try the -h option for ls:

$ ls -lh /home/group/common/training/Intro_to_Unix/expectations.txt
-rw-r--r-- 1 arobinson common 1010K Mar 26  2012 /home/group/common/training/Intro_to_Unix/expectations.txt

In this case the size is reported in kilobytes as 1010K. Larger files are reported in megabytes, gigabytes etcetera.


Note: this exercise assumes your working directory is ~/test; if not run cd ~/test

4.4) Check that the contents of expectations.txt are the same in both the directory that you copied it from and the directory that you copied it to.

What is the opposite of same?

difference

Use the diff command to compare the contents of two files.

$ diff /home/group/common/training/Intro_to_Unix/expectations.txt expectations.txt

If the two files are identical the diff command will NOT produce any output)

Answer: Yes, they are the same since no output was given.


4.5) How many lines, words and characters are in expectations.txt?

Initialisms are key

word count

Use the wc (for "word count") to count the number of characters, lines and words in a file:

$ wc expectations.txt
  20415  187465 1033773 expectations.txt

Answer: There are 20415 lines, 187465 words and 1033773 characters in expectations.txt.

To get just the line, word or character count:

$ wc -l expectations.txt
20415 expectations.txt
$ wc -w expectations.txt
187465 expectations.txt
$ wc -c expectations.txt
1033773 expectations.txt

4.6) Open ~/test/expectations.txt in the nano text editor, delete the first line of text, and save your changes to the file. Exit nano.

nano FILENAME

Once nano is open it displays some command hints along the bottom of the screen.

^O means hold the Control (or CTRL) key while pressing the o. Dispite what it displays, you need to type the lower-case letter that follows the ^ character.

WriteOut is another name for Save.

Take some time to play around with the nano text editor.

Nano is a very simple text editor which is easy to use but limited in features. More powerful editors exist such as vim and emacs, however they take a substantial amount of time to learn.


4.7) Did the changes you made to ~/test/expectations.txt have any effect on /home/group/common/training/Intro_to_Unix/expectations.txt? How can you tell if two files are the same or different in their contents?

Remember exercise 4.4

Use diff

Use diff to check that the two files are different after you have made the change to the copy of expectations.txt in your ~/test directory.

diff ~/test/expectations.txt \
/home/group/common/training/Intro_to_Unix/expectations.txt

You could also use ls to check that the files have different sizes.


4.8) In your test subdirectory, rename expectations.txt to foo.txt.

Another way to think of it is moving it from expectations.txt to foo.txt

mv

Use man mv if you need to work out how to use it.

Use the mv command to rename the file:

$ mv expectations.txt foo.txt
$ ls
foo.txt  hello.c  hi  jude.txt  moby.txt  sample_1.fastq  sleepy

4.9) Rename foo.txt back to expectations.txt.

Use the mv command to rename the file:

$ mv foo.txt expectations.txt
$ ls
expectations.txt  hello.c  hi  jude.txt  moby.txt  sample_1.fastq  sleepy

Use ls to check that the file is in fact renamed.


4.10) Remove the file expectations.txt from your test directory.

We are trying to remove a file, check the commands at the top of this topic.

rm

Use the rm command to remove files (carefully):

$ rm expectations.txt
$ ls
hello.c  hi  jude.txt  moby.txt  sample_1.fastq  sleepy

4.11) Remove the entire test directory and all the files within it.

We are trying to remove a directory.

You could use rmdir but there is an easier way using just rm and a flag.

You could use the rm command to remove each file individually, and then use the rmdir command to remove the directory. Note that rmdir will only remove directories that are empty (i.e. do not contain files or subdirectories).

A faster way is to pass the -r (for recursive) flag to rm to remove all the files and the directory in one go:

Logical Answer:

cd ~
rm test/*
rmdir test

Easier Answer:

cd ~
rm -r test
Warning: Be very careful with rm -r, it will remove all files and all subdirectories underneath the specified directory. This could be catastrophic if you do it in the wrong location! Now is a good moment to pause and think about file backup strategies.

4.12) Recreate the test directory in your home directory and copy all the files from /home/group/common/training/Intro_to_Unix/ back into the test directory.

See exercises 4.1 and 4.2

Repeat exercises 4.1 and 4.2.

$ cd ~
$ mkdir test
$ cp /home/group/common/training/Intro_to_Unix/* test

4.13) Change directories to ~/test and use the cat command to display the entire contents of the file hello.c

Use man if you can't guess how it might work.

$ cd ~/test
$ cat hello.c
#include <stdio.h>
int main(void) {
    printf ("Hello World\n");
    return 0;
}

hello.c contains the source code of a C program. The compiled executable version of this code is in the file called hi, which you can run like so:

$ ./hi
Hello World

4.14) Use the head command to view the first 20 lines of the file sample_1.fastq

Remember your best friend!

Use man to find out what option you need to add to display a given number of lines.

$ head -20 sample_1.fastq
@IRIS:7:1:17:394#0/1
GTCAGGACAAGAAAGACAANTCCAATTNACATTATG
+IRIS:7:1:17:394#0/1
aaabaa`]baaaaa_aab]D^^`b`aYDW]abaa`^
@IRIS:7:1:17:800#0/1
GGAAACACTACTTAGGCTTATAAGATCNGGTTGCGG
+IRIS:7:1:17:800#0/1
ababbaaabaaaaa`]`ba`]`aaaaYD\\_a``XT
@IRIS:7:1:17:1757#0/1
TTTTCTCGACGATTTCCACTCCTGGTCNACGAATCC
+IRIS:7:1:17:1757#0/1
aaaaaa``aaa`aaaa_^a```]][Z[DY^XYV^_Y
@IRIS:7:1:17:1479#0/1
CATATTGTAGGGTGGATCTCGAAAGATATGAAAGAT
+IRIS:7:1:17:1479#0/1
abaaaaa`a```^aaaaa`_]aaa`aaa__a_X]``
@IRIS:7:1:17:150#0/1
TGATGTACTATGCATATGAACTTGTATGCAAAGTGG
+IRIS:7:1:17:150#0/1
abaabaa`aaaaaaa^ba_]]aaa^aaaaa_^][aa

4.15) Use the tail command to view the last 8 lines of the file sample_1.fastq

Its very much like head.

tail -8 sample_1.fastq
@IRIS:7:32:731:717#0/1
TAATAATTGGAGCCAAATCATGAATCAAAGGACATA
+IRIS:7:32:731:717#0/1
ababbababbab]abbaa`babaaabbb`bbbabbb
@IRIS:7:32:731:1228#0/1
CTGATGCCGAGGCACGCCGTTAGGCGCGTGCTGCAG
+IRIS:7:32:731:1228#0/1
`aaaaa``aaa`a``a`^a`a`a_[a_a`a`aa`__

4.16) Use the grep command to find out all the lines in moby.txt that contain the word "Ahab"

One might say we are 'looking for the pattern "Ahab"'

$ man grep
...
SYNOPSIS
       grep [OPTIONS] PATTERN [FILE...]
...
$ grep Ahab moby.txt
"Want to see what whaling is, eh? Have ye clapped eye on Captain Ahab?"
"Who is Captain Ahab, sir?"
"Aye, aye, I thought so. Captain Ahab is the Captain of this ship."
... AND MUCH MUCH MORE ...

If you want to know how many lines are in the output of the above command you can "pipe" it into the wc -l command:

$ grep Ahab moby.txt | wc -l
491

which shows that there are 491 lines in moby.txt that contain the word Ahab.


4.17) Use the grep command to find out all the lines in expectations.txt that contain the word "the" with a case insensitive search (it should count "the" "The" "THE" "tHe" etcetera) .

One might say we are ignoring case.

$ man grep
...
       -i, --ignore-case
              Ignore case distinctions in both the PATTERN and the input files.  (-i is specified by POSIX.)
...

Use the -i flag to grep to make it perform case insensitive search:

$ grep -i the expectations.txt
The Project Gutenberg EBook of Great Expectations, by Charles Dickens
This eBook is for the use of anyone anywhere at no cost and with
re-use it under the terms of the Project Gutenberg License included
[Project Gutenberg Editor's Note: There is also another version of
... AND MUCH MUCH MORE ...

Again, "pipe" the output to wc -l to count the number of lines:

$ grep -i the expectations.txt  | wc -l
8165

4.18) Use the gzip command to compress the file sample_1.fastq. Use gunzip to decompress it back to the original contents.

Use the above commands along with man and ls to see what happens to the file.

Check the file size of sample_1.fastq before compressing it:

# check filesize
$ ls -l sample_1.fastq
-rw-r--r-- 1 training01 training 90849644 Jun 14 20:03 sample_1.fastq

# compress it (takes a few seconds)
$ gzip sample_1.fastq

# check filesize (Note: its name changed)
$ ls -l sample_1.fastq.gz
-rw-r--r-- 1 training01 training 26997595 Jun 14 20:03 sample_1.fastq.gz

# decompress it
$ gunzip sample_1.fastq.gz

$ ls -l sample_1.fastq
-rw-r--r-- 1 training01 training 90849644 Jun 14 20:03 sample_1.fastq

You will see that when it was compressed it is 26997595 bytes in size, making it about 0.3 times the size of the original file.

Note: in the above section the lines starting with # are comments so don't need to be copied but if you do then they wont do anything.

Topic 5: Pipes, output redirection and shell scripts

In this section we will cover a lot of the more advanced Unix concepts; it is here where you will start to see the power of Unix. I say start because this is only the "tip of the iceberg".

Duration: 50 minutes.

Relevant commands: wc, paste, grep, sort, uniq, nano, cut

5.1) How many reads are contained in the file sample_1.fastq?

Examine some of the file to work out how many lines each read takes up.

Count the number of lines

We can answer this question by counting the number of lines in the file and dividing by 4:

$ wc -l sample_1.fastq
3000000

Answer: There are 3000000 lines in the file representing 750000 reads.

If you want to do simple arithmetic at the command line then you can use the "basic calculator" called bc:

$ echo "3000000 / 4" | bc
750000
Note: that the vertical bar character "|" is the Unix pipe (and is often called the "pipe symbol"). It is used for connecting the output of one command into the input of another command. We'll see more examples soon.

bc is suitable for small calculations, but it becomes cumbersome for more complex examples. If you want to do more sophisticated calculations then we recommend to use a more general purpose programming language (such as Python etcetera).


5.2) How many reads in sample_1.fastq contain the sequence GATTACA?

Check out exercise 4.16

Use grep to find all the lines that contain GATTACA and "pipe" the output to wc -l to count them:

$ grep GATTACA sample_1.fastq | wc -l
1119

Answer: 1119

If you are unsure about the possibility of upper and lower case characters then consider using the -i (ignore case option for grep).


5.3) On what line numbers do the sequences containing GATTACA occur?

We are looking for the line numbers.

Check out the manpage for grep and/or nl

You can use the -n flag to grep to make it prefix each line with a line number:

Answer 1:

$ grep -n GATTACA sample_1.fastq
5078:AGGAAGATTACAACTCCAAGACACCAAACAAATTCC
7170:AACTACAAAGGTCAGGATTACAAGCTCTTGCCCTTC
8238:ATAGTTTTTTCGATTACATGGATTATATCTGTTTGC
... AND MUCH MUCH MORE ...

Answer 2: Or you can use the nl command to number each line of sample_1.fastq and then search for GATTACA in the numbered lines:

$ nl sample_1.fastq | grep GATTACA
  5078  AGGAAGATTACAACTCCAAGACACCAAACAAATTCC
  7170  AACTACAAAGGTCAGGATTACAAGCTCTTGCCCTTC
  8238  ATAGTTTTTTCGATTACATGGATTATATCTGTTTGC
... AND MUCH MUCH MORE ...

Just the line numbers:

If you just want to see the line numbers then you can "pipe" the output of the above command into cut -f 1:

$ nl sample_1.fastq | grep GATTACA | cut -f 1
  5078
  7170
  8238
... AND MUCH MUCH MORE ...

cut will remove certain columns from the input; in this case it will remove all except column 1 (a.k.a. field 1, hence the -f 1 option)

$ grep -n GATTACA sample_1.fastq | cut -d: -f 1
5078
7170
8238
... AND MUCH MUCH MORE ...

5.4) Use the nl command to print each line of sample_1.fastq with its corresponding line number at the beginning.

Check answer to 5.3.

$ nl sample_1.fastq
     1  @IRIS:7:1:17:394#0/1
     2  GTCAGGACAAGAAAGACAANTCCAATTNACATTATG
     3  +IRIS:7:1:17:394#0/1
     4  aaabaa`]baaaaa_aab]D^^`b`aYDW]abaa`^
     5  @IRIS:7:1:17:800#0/1
     6  GGAAACACTACTTAGGCTTATAAGATCNGGTTGCGG
     7  +IRIS:7:1:17:800#0/1
     8  ababbaaabaaaaa`]`ba`]`aaaaYD\\_a``XT
... AND MUCH MUCH MORE ...

There are a lot of lines in that file so this command might take a while to print all its output. If you get tired of looking at the output you can kill the command with control-c (hold the control key down and simultaneously press the "c" character).


5.5) Redirect the output of the previous command to a file called sample_1.fastq.nl. Check the first 20 lines of sample_1.fastq.nl with the head command. Use the less command to interactively view the contents of sample_1.fastq.nl (use the arrow keys to navigate up and down, q to quit and '/' to search). Use the search facility in less to find occurrences of GATTACA.

Ok that one was tough, > FILENAME is how you do it if you didn't break out an internet search for "redirect the output in Unix"

$ nl sample_1.fastq > sample_1.fastq.nl

The greater-than sign ">" is the file redirection operator. It causes the standard output of the command on the left-hand-side to be written to the file on the right-hand-side.

You should notice that the above command is much faster than printing the output to the screen. This is because writing to disk can be performed much more quickly than rendering the output on a terminal.

To check that the first 20 lines of the file look reasonable you can use the head command like so:

$ head -20 sample_1.fastq.nl
     1  @IRIS:7:1:17:394#0/1
     2  GTCAGGACAAGAAAGACAANTCCAATTNACATTATG
     3  +IRIS:7:1:17:394#0/1
     4  aaabaa`]baaaaa_aab]D^^`b`aYDW]abaa`^
     5  @IRIS:7:1:17:800#0/1
     6  GGAAACACTACTTAGGCTTATAAGATCNGGTTGCGG
     7  +IRIS:7:1:17:800#0/1
     8  ababbaaabaaaaa`]`ba`]`aaaaYD\\_a``XT
...

The less command allows you to interactively view a file. The arrow keys move the page up and down. You can search using the '/' followed by the search term. You can quit by pressing "q". Note that the less command is used by default to display man pages.

$ less sample_1.fastq.nl

The '-' (dash) character has a special meaning when used in place of a file; it means use the standard input instead of a real file. Note: while it is fairly common in most Unix programs, not all wil support it.

The paste command is useful for merging multiple files together line-by-line, such that the Nth line from each file is joined together into one line in the output, separated by default with a tab character. In the above example we give paste 4 copies of the contents of sample_1.fastq, which causes it to join consecutive groups of 4 lines from the file into one line of output.


$ paste sample_1.fastq sample_1.fastq sample_1.fastq sample_1.fastq > sample_1b.tsv

Try it, see what ends up in sample_1b.tsv (maybe use less)

Use less to examine it.

Answer: No, in the second instance we get 4 copies of each line.

Why: In the first command paste will use the input file (standard input) 4 times since the cat command will only give one copy of the file to paste, where as, in the second command paste will open the file 4 times. Note: this is quite confusing and is not necessory to remember; its just an interesting side point.


5.8) Check that sample_1.tsv has the correct number of lines. Use the head command to view the first 20 lines of the file.

Remember the wc command.

We can count the number of lines in sample_1.tsv using wc:

$ wc -l sample_1.tsv

The output should be 750000 as expected (1/4 of the number of lines in sample_1.fastq).

To view the first 20 lines of sample_1.tsv use the head command:

$ head -20 sample_1.tsv

5.9) Use the cut command to print out the second column of sample_1.tsv. Redirect the output to a file called sample_1.dna.txt.

See exercise 5.3 (for cut) and 5.5 (redirection)

The file sample_1.tsv is in column format. The cut command can be used to select certain columns from the file. The DNA sequences appear in column 2, we select that column using the -f 2 flag (the f stands for "field").

cut -f 2 sample_1.tsv > sample_1.dna.txt

Check that the output file looks reasonable using head or less.


5.10) Use the sort command to sort the lines of sample_1.dna.txt and redirect the output to sample_1.dna.sorted.txt. Use head to look at the first few lines of the output file. You should see a lot of repeated sequences of As.

Use man (sort) and see exercise 5.5 (redirection)

$ sort sample_1.dna.txt > sample_1.dna.sorted.txt

Running head on the output file reveals that there are duplicate DNA sequences in the input FASTQ file.


5.11) Use the uniq command to remove duplicate consecutive lines from sample_1.dna.sorted.txt, redirect the result to sample_1.dna.uniq.txt. Compare the number of lines in sample1_dna.txt to the number of lines in sample_1.dna.uniq.txt.

I am pretty sure you have already used man (or just guessed how to use uniq). You're also a gun at redirection now.

$ uniq sample_1.dna.sorted.txt > sample_1.dna.uniq.txt

Compare the outputs of:

$ wc -l sample_1.dna.sorted.txt
750000
$ wc -l sample_1.dna.uniq.txt
614490

View the contents of sample_1.dna.uniq.txt to check that the duplicate DNA sequences have been removed.


5.12) Can you modify the command from above to produce only those sequences of DNA which were duplicated in sample_1.dna.sorted.txt?

Checkout the uniq manpage

Look at the man page for uniq.

Use the -d flag to uniq to print out only the duplicated lines from the file:

$ uniq -d sample_1.dna.sorted.txt > sample_1.dna.dup.txt

5.13) Write a shell pipeline which will print the number of duplicated DNA sequences in sample_1.fastq.

That is, piping most of the commands you used above instead of redirecting to file

I.e. 6 commands (cat, paste, cut, sort, uniq, wc)

Finally we can 'pipe' all the pieces together into a sophisticated pipeline which starts with a FASTQ file and ends with a list of duplicated DNA sequences:

Answer:

$ cat sample_1.fastq | paste - - - - | cut -f 2 | sort | uniq -d | wc -l
56079

The output file should have 56079 lines.


5.14) (Advanced) Write a shell script which will print the number of duplicated DNA sequences in sample_1.fastq.

Check out the sleepy file (with cat or nano); there is a bit of magic on the first line that you will need.

You also need to tell bash that this file can be executed (check out chmod command).

Put the answer to 5.13 into a file called sample_1_dups.sh (or whatever you want). Use nano to create the file.

Answer: the contents of the file will look like this:

#!/bin/bash

cat sample_1.fastq | paste - - - - | cut -f 2 | sort | uniq -d | wc -l
Note: the first line has special meaning. If it starts with '#!' (Hash then exclamation mark) then it tells bash this file is a script that can be interpreted. The command (including full path) used to intepret the script is placed right after the magic code.

Give everyone execute permissions on the file with chmod:

$ chmod +x sample_1_dups.sh 

You can run the script like so:

$ ./sample_1_dups.sh

If all goes well the script should behave in exactly the same way as the answer to 5.13.


5.15) (Advanced) Modify your shell script so that it accepts the name of the input FASTQ file as a command line parameter.

Shell scripts can refer to command line arguments by their position using special variables called $0, $1, $2 and so on.

$0 refers to the name of the script as it was called on the command line. $1 refers to the first command line argument, and so on.

Copy the shell script from 5.14 into a new file:

$ cp sample_1_dups.sh fastq_dups.sh

Edit the new shell script file and change it to use the command line parameters:

#!/bin/bash

cat $1 | paste - - - - | cut -f 2 | sort | uniq -d | wc -l

You can run the new script like so:

$ ./fastq_dups.sh sample_1.fastq

In the above example the script takes sample_1.fastq as input and prints the number of duplicated sequences as output.

A better Answer:

Ideally we would write our shell script to be more robust. At the moment it just assumes there will be at least one command line argument. However, it would be better to check and produce an error message if insufficient arguments were given:

#!/bin/bash
if [ $# -eq 1 ]; then
    cat $1 | paste - - - - | cut -f 2 | sort | uniq -d | wc -l
else
    echo "Usage: $0 <fastq_filename>"
    exit 1
fi

The 'if ...; then' line means: do the following line(s) ONLY if the ... (called condition) bit is true.

The 'else' line means: otherwise do the following line(s) instead. Note: it is optional.

The 'fi' line means: this marks the end of the current if or else section.

The '[ $# -eq 1 ]' part is the condition:

  • $#: is a special shell variable that indicates how many command line arguments were given.
  • -eq: checks if the numbers on either side if it are equal.
  • 1: is a number one
Spaces in conditions: Bash is VERY picky about the spaces within the conditions; if you get it wrong it will just behave strangely (without warning). You MUST put a space near the share brackets and between each part of the condition!

So in words our script is saying "if user provided 1 filename, then count the duplicates, otherwise print an error".

Exit-status: It is a Unix standard that when the user provides incorrect commandline arguments we print a usage message and return a *non-zero* exit status. The *exit status* is a standard way for other programs to know if our program ran correctly; 0 means everything went as expected, any other number is an error. If you don't provide an *exit ..* line then it automatically returns a 0 for you.

5.16) (Advanced) Modify your shell script so that it accepts zero or more FASTQ files on the command line argument and outputs the number of duplicated DNA sequences in each file.

We can add a loop to our script to accept multiple input FASTQ files:

#!/bin/bash
for file in $@; do
    dups=$(cat $file | paste - - - - | cut -f 2 | sort | uniq -d | wc -l)
    echo "$file $dups"
done

There's a lot going on in this script.

The $@ is a sequence of all command line arguments.

The 'for ...; do' (a.k.a. for loop) iterates over that sequence one argument at a time, assigning the current argument in the sequence to the variable called file.

The $(...) allow us to capture the output of another command (in-place of the ...). In this case we capture the output of the pipeline and save it to the variable called dups.

If you had multiple FASTQ files available you could run the script like so:

./fastq_dups.sh sample_1.fastq sample_2.fastq sample_3.fastq

And it would produce output like:

sample_1.fastq 56079
sample_2.fastq XXXXX
sample_3.fastq YYYYY

Finished

Well done, you learnt a lot over the last 5 topics and you should be proud of your achievement; it was a lot to take in.

From here you should be confortable around the Unix command line and ready to take on the HPC Workshop.

You will no-doubt forget a lot of what you learnt here so I encourage you to save a link to this Workshop for later reference.

Thank you for your attendance, please don't forget to complete the Melbourne Bioinformatics training survey and give it back to the Workshop facilitators.